Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300078 |
| Name | oriT_JN100  |
| Organism | Expression vector JN100 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ309424 (_) |
| oriT length | 119 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 119 nt
>oriT_JN100
ATATGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCA
ATATGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Nikodinovic J et al. (2006) A second generation snp-derived Escherichia coli-Streptomyces shuttle expression vector that is generally transferable by conjugation. Plasmid. 56(3):223-7. [PMID:16806469]
Host bacterium
| ID | 291 | GenBank | DQ309424 |
| Plasmid name | Expression vector JN100 | Incompatibility group | ColRNAI |
| Plasmid size | 6460 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression vector JN100 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |