Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300072 |
| Name | oriT_pJB861  |
| Organism | Expression vector pJB861 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | U82000 (_) |
| oriT length | 111 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pJB861
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Blatny JM et al. (1997) Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in gram-negative bacteria. Plasmid. 38(1):35-51. [PMID:9281494]
Host bacterium
| ID | 285 | GenBank | U82000 |
| Plasmid name | Expression vector pJB861 | Incompatibility group | IncP1 |
| Plasmid size | 7243 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression vector pJB861 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |