Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300070 |
Name | oriT_pJB3Cm6 |
Organism | Cloning vector pJB3Cm6 |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | U75322 (_) |
oriT length | 111 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pJB3Cm6
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Blatny JM et al. (1997) Construction and use of a versatile set of broad-host-range cloning and expression vectors based on the RK2 replicon. Appl Environ Microbiol. 63(2):370-9. [PMID:9023917]
Host bacterium
ID | 283 | GenBank | U75322 |
Plasmid name | Cloning vector pJB3Cm6 | Incompatibility group | IncP1 |
Plasmid size | 6227 bp | Coordinate of oriT [Strand] | |
Host baterium | Cloning vector pJB3Cm6 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |