Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300066
Name   oriT_pJB137 experimental
Organism   Expression vector pJB137
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   U75326 (_)
oriT length   111 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 111 nt

>oriT_pJB137
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Blatny JM et al. (1997) Construction and use of a versatile set of broad-host-range cloning and expression vectors based on the RK2 replicon. Appl Environ Microbiol. 63(2):370-9. [PMID:9023917]


Host bacterium


ID   279 GenBank   U75326
Plasmid name   Expression vector pJB137 Incompatibility group   IncP1
Plasmid size   7643 bp Coordinate of oriT [Strand]   
Host baterium   Expression vector pJB137

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -