Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300063 |
| Name | oriT_pPR9TT  |
| Organism | Promoter probe vector pPR9TT |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AF187996 (_) |
| oriT length | 64 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 64 nt
>oriT_pPR9TT
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Santos PM et al. (2000) Physiological analysis of the expression of the styrene degradation gene cluster in Pseudomonas fluorescens ST. Appl Environ Microbiol. 66(4):1305-10. [PMID:10742204]
Host bacterium
| ID | 276 | GenBank | AF187996 |
| Plasmid name | Promoter probe vector pPR9TT | Incompatibility group | IncP1 |
| Plasmid size | 9388 bp | Coordinate of oriT [Strand] | |
| Host baterium | Promoter probe vector pPR9TT |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |