Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300062 |
| Name | oriT_pJB785TTKm1  |
| Organism | Promoter probe vector pJB785TTKm1 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AF320510 (_) |
| oriT length | 64 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 64 nt
>oriT_pJB785TTKm1
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Santos PM et al. (2001) New broad-host-range promoter probe vectors based on the plasmid RK2 replicon. FEMS Microbiol Lett. 195(1):91-6. [PMID:11167001]
Host bacterium
| ID | 275 | GenBank | AF320510 |
| Plasmid name | Promoter probe vector pJB785TTKm1 | Incompatibility group | IncP1 |
| Plasmid size | 7682 bp | Coordinate of oriT [Strand] | |
| Host baterium | Promoter probe vector pJB785TTKm1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |