Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300061 |
| Name | oriT_pELS100  |
| Organism | Shuttle vector pELS100 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY557620 (_) |
| oriT length | 111 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pELS100
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Rawlinson EL et al. (2002) LasX, a transcriptional regulator of the lactocin S biosynthetic genes in Lactobacillus sakei L45, acts both as an activator and a repressor. Biochimie. 84(5-6):559-67. [PMID:12423800]
Host bacterium
| ID | 274 | GenBank | AY557620 |
| Plasmid name | Shuttle vector pELS100 | Incompatibility group | IncP1 |
| Plasmid size | 7022 bp | Coordinate of oriT [Strand] | |
| Host baterium | Shuttle vector pELS100 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |