Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300058 |
| Name | oriT_pBELG |
| Organism | Integrational vector pBELG |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JQ663863 (5178..5423 [-], 246 nt) |
| oriT length | 246 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 246 nt
>oriT_pBELG
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Nikel PI et al. (2013) Implantation of unmarked regulatory and metabolic modules in Gram-negative bacteria with specialised mini-transposon delivery vectors. J Biotechnol. 163(2):143-54. [PMID:22609234]
Host bacterium
| ID | 271 | GenBank | JQ663863 |
| Plasmid name | Integrational vector pBELG | Incompatibility group | - |
| Plasmid size | 5842 bp | Coordinate of oriT [Strand] | 5178..5423 [-] |
| Host baterium | Integrational vector pBELG |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |