Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300055
Name   oriT_pBEXK experimental
Organism   Integrational vector pBEXK
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JQ663866 (5831..6076 [-], 246 nt)
oriT length   246 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RK2

  oriT sequence  


Download         Length: 246 nt

>oriT_pBEXK
CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Nikel PI et al. (2013) Implantation of unmarked regulatory and metabolic modules in Gram-negative bacteria with specialised mini-transposon delivery vectors. J Biotechnol. 163(2):143-54. [PMID:22609234]


Host bacterium


ID   268 GenBank   JQ663866
Plasmid name   Integrational vector pBEXK Incompatibility group   -
Plasmid size   6495 bp Coordinate of oriT [Strand]   5831..6076 [-]
Host baterium   Integrational vector pBEXK

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -