Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300053 |
| Name | oriT_pIMB4  |
| Organism | Expression shuttle vector pIMB4 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | HM756283 (_) |
| oriT length | 111 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RK2 |
oriT sequence
Download Length: 111 nt
>oriT_pIMB4
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Zhu Y et al. (2011) Heterologous expression of human interleukin-6 in Streptomyces lividans TK24 using novel secretory expression vectors. Biotechnol Lett. 33(2):253-61. [PMID:20931350]
Host bacterium
| ID | 266 | GenBank | HM756283 |
| Plasmid name | Expression shuttle vector pIMB4 | Incompatibility group | ColRNAI |
| Plasmid size | 8703 bp | Coordinate of oriT [Strand] | |
| Host baterium | Expression shuttle vector pIMB4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |