Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300052 |
| Name | oriT_pIJ6902  |
| Organism | Cloning vector pIJ6902 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AJ937361 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 112 nt
>oriT_pIJ6902
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Huang J et al. (2005) Cross-regulation among disparate antibiotic biosynthetic pathways of Streptomyces coelicolor. Mol Microbiol. 58(5):1276-87. [PMID:16313616]
Host bacterium
| ID | 265 | GenBank | AJ937361 |
| Plasmid name | Cloning vector pIJ6902 | Incompatibility group | ColRNAI |
| Plasmid size | 7340 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pIJ6902 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |