Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300050 |
| Name | oriT_pSW4426T  |
| Organism | Cloning vector pSW4426T |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ995482 (35..291 [-], 257 nt) |
| oriT length | 257 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 257 nt
>oriT_pSW4426T
GGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCG
GGTACCAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Le Roux F et al. (2007) Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vector. Appl Environ Microbiol. 73(3):777-84. [PMID:17122399]
Host bacterium
| ID | 263 | GenBank | DQ995482 |
| Plasmid name | Cloning vector pSW4426T | Incompatibility group | - |
| Plasmid size | 4424 bp | Coordinate of oriT [Strand] | 35..291 [-] |
| Host baterium | Cloning vector pSW4426T |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |