Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300047
Name   oriT_pMK2030 experimental
Organism   Reporter vector pMK2030
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU825945 (_)
oriT length   336 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 336 nt

>oriT_pMK2030
AATTCCGTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATGAGGGCAAGCGGATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCACGGAATT

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Humann JL et al. (2008) Construction and expression of sugar kinase transcriptional gene fusions by using the Sinorhizobium meliloti ORFeome. Appl Environ Microbiol. 74(21):6756-65. [PMID:18791020]


Host bacterium


ID   260 GenBank   EU825945
Plasmid name   Reporter vector pMK2030 Incompatibility group   -
Plasmid size   6926 bp Coordinate of oriT [Strand]   
Host baterium   Reporter vector pMK2030

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -