Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300037 |
| Name | oriT_pJK100  |
| Organism | Allelic exchange vector pJK100 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ157769 (_) |
| oriT length | 60 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 60 nt
>oriT_pJK100
CAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTC
CAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Denef et al. (2006) Genetic and Genomic Insights into the Role of Benzoate-Catabolic Pathway Redundancy in Burkholderia xenovorans LB400. Appl Environ Microbiol. 72(1):585-95. [PMID:16391095]
Host bacterium
| ID | 250 | GenBank | DQ157769 |
| Plasmid name | Allelic exchange vector pJK100 | Incompatibility group | - |
| Plasmid size | 3854 bp | Coordinate of oriT [Strand] | |
| Host baterium | Allelic exchange vector pJK100 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |