Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300034 |
| Name | oriT_pGRG36pir-116  |
| Organism | Cloning vector pGRG36pir-116 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | JX239261 (_) |
| oriT length | 87 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 87 nt
>oriT_pGRG36pir-116
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCAC
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCAC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Kvitko BH et al. (2012) A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids. BMC Res Notes. 0.317361111. [PMID:22433797]
Host bacterium
| ID | 247 | GenBank | JX239261 |
| Plasmid name | Cloning vector pGRG36pir-116 | Incompatibility group | ColE10 |
| Plasmid size | 13905 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector pGRG36pir-116 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |