Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300033
Name   oriT_pGRG36pir-116-FKm experimental
Organism   Cloning vector pGRG36pir-116-FKm
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   JX239262 (_)
oriT length   87 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 87 nt

>oriT_pGRG36pir-116-FKm
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCAC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Kvitko BH et al. (2012) A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids. BMC Res Notes. 0.317361111. [PMID:22433797]


Host bacterium


ID   246 GenBank   JX239262
Plasmid name   Cloning vector pGRG36pir-116-FKm Incompatibility group   ColE10
Plasmid size   15375 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pGRG36pir-116-FKm

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -