Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 300033 |
Name | oriT_pGRG36pir-116-FKm |
Organism | Cloning vector pGRG36pir-116-FKm |
Sequence Completeness | |
NCBI accession of oriT (coordinates [strand]) | JX239262 (_) |
oriT length | 87 nt |
IRs (inverted repeats) | |
Location of nic site | |
Conserved sequence flanking the nic site |
|
Note | oriT_RP4 |
oriT sequence
Download Length: 87 nt
>oriT_pGRG36pir-116-FKm
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCAC
GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCAC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure fileReference
[1] Kvitko BH et al. (2012) A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids. BMC Res Notes. 0.317361111. [PMID:22433797]
Host bacterium
ID | 246 | GenBank | JX239262 |
Plasmid name | Cloning vector pGRG36pir-116-FKm | Incompatibility group | ColE10 |
Plasmid size | 15375 bp | Coordinate of oriT [Strand] | |
Host baterium | Cloning vector pGRG36pir-116-FKm |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |