Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300032 |
| Name | oriT_pGRG36  |
| Organism | Tn7 delivery vector pGRG36 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ460223 (_) |
| oriT length | 89 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 89 nt
>oriT_pGRG36
CGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACC
CGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] McKenzie GJ et al. (2006) Fast, easy and efficient: site-specific insertion of transgenes into enterobacterial chromosomes using Tn7 without need for selection of the insertion event. BMC Microbiol. 0.277083333. [PMID:16646962]
Host bacterium
| ID | 245 | GenBank | DQ460223 |
| Plasmid name | Tn7 delivery vector pGRG36 | Incompatibility group | ColE10 |
| Plasmid size | 12549 bp | Coordinate of oriT [Strand] | |
| Host baterium | Tn7 delivery vector pGRG36 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |