Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300031 |
| Name | oriT_pHZ1358  |
| Organism | Shuttle cosmid vector pHZ1358 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AY667410 (9007..9105 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 99 nt
>oriT_pHZ1358
TGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTC
TGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sun Y et al. (2002) Streptomyces nanchangensis', a producer of the insecticidal polyether antibiotic nanchangmycin and the antiparasitic macrolide meilingmycin, contains multiple polyketide gene clusters. Microbiology. 148(Pt 2):361-71. [PMID:11832500]
Host bacterium
| ID | 244 | GenBank | AY667410 |
| Plasmid name | Shuttle cosmid vector pHZ1358 | Incompatibility group | ColRNAI |
| Plasmid size | 10848 bp | Coordinate of oriT [Strand] | 9007..9105 [-] |
| Host baterium | Shuttle cosmid vector pHZ1358 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |