Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300030 |
| Name | oriT_pSET152  |
| Organism | Cloning vector PSET152 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | AJ414670 (_) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 112 nt
>oriT_pSET152
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sun Y et al. (2002) Streptomyces nanchangensis', a producer of the insecticidal polyether antibiotic nanchangmycin and the antiparasitic macrolide meilingmycin, contains multiple polyketide gene clusters. Microbiology. 148(Pt 2):361-71. [PMID:11832500]
Host bacterium
| ID | 243 | GenBank | AJ414670 |
| Plasmid name | Cloning vector pSET152 | Incompatibility group | ColRNAI |
| Plasmid size | 5715 bp | Coordinate of oriT [Strand] | |
| Host baterium | Cloning vector PSET152 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |