Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 300029 |
| Name | oriT_pHW001  |
| Organism | Conjugative vector pHW001 |
| Sequence Completeness | |
| NCBI accession of oriT (coordinates [strand]) | DQ457004 (608..719 [-], 112 nt) |
| oriT length | 112 nt |
| IRs (inverted repeats) | |
| Location of nic site | |
| Conserved sequence flanking the nic site |
|
| Note | oriT_RP4 |
oriT sequence
Download Length: 112 nt
>oriT_pHW001
CCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
CCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 242 | GenBank | DQ457004 |
| Plasmid name | Conjugative vector pHW001 | Incompatibility group | ColRNAI |
| Plasmid size | 4664 bp | Coordinate of oriT [Strand] | 608..719 [-] |
| Host baterium | Conjugative vector pHW001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |