Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300028
Name   oriT_pMQ122 experimental
Organism   Shuttle vector pMQ122
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU483152 (_)
oriT length   260 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 260 nt

>oriT_pMQ122
AGCTTATCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAGTATACCTTAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] House BL et al. (2004) New yeast recombineering tools for bacteria. Appl Environ Microbiol. 70(5):2806-15. [PMID:19477196]


Host bacterium


ID   241 GenBank   EU483152
Plasmid name   Shuttle vector pMQ122 Incompatibility group   ColRNAI
Plasmid size   8035 bp Coordinate of oriT [Strand]   
Host baterium   Shuttle vector pMQ122

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -