Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300014
Name   oriT_pMK2010 experimental
Organism   Cloning vector pMK2010
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   AY423863 (_)
oriT length   326 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 326 nt

>oriT_pMK2010
CGTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATGAGGGCAAGCGGATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCACG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] House BL et al. (2004) New recombination methods for Sinorhizobium meliloti genetics. Appl Environ Microbiol. 70(5):2806-15. [PMID:15128536]


Host bacterium


ID   227 GenBank   AY423863
Plasmid name   Cloning vector pMK2010 Incompatibility group   ColRNAI
Plasmid size   4892 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pMK2010

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -