Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300011
Name   oriT_pTAP6 experimental
Organism   Cloning vector pTAP6
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   HM536627 (_)
oriT length   246 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 246 nt

>oriT_pTAP6
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAAAGC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Dodsworth JA et al. (2010) Interdomain conjugal transfer of DNA from bacteria to archaea. Appl Environ Microbiol. 76(16):5644-7. [PMID:20581182]


Host bacterium


ID   224 GenBank   HM536627
Plasmid name   Cloning vector pTAP6 Incompatibility group   ColRNAI
Plasmid size   6479 bp Coordinate of oriT [Strand]   
Host baterium   Cloning vector pTAP6

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -