Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   300010
Name   oriT_pEX18Tp-pheS experimental
Organism   Suicide vector pEX18Tp-pheS
Sequence Completeness      
NCBI accession of oriT (coordinates [strand])   EU334848 (_)
oriT length   242 nt
IRs (inverted repeats)    
Location of nic site      
Conserved sequence flanking the
  nic site  
 
 
Note   oriT_RP4

  oriT sequence  


Download         Length: 242 nt

>oriT_pEX18Tp-pheS
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCCGAAGCAGGGTTATGCAGCGGAAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Barrett AR et al. (2008) Genetic tools for allelic replacement in Burkholderia species. Appl Environ Microbiol. 74(14):4498-508. [PMID:18502918]


Host bacterium


ID   223 GenBank   EU334848
Plasmid name   Suicide vector pEX18Tp-pheS Incompatibility group   ColRNAI
Plasmid size   4490 bp Coordinate of oriT [Strand]   
Host baterium   Suicide vector pEX18Tp-pheS

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -