Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200582 |
| Name | oriT_SGI-0  |
| Organism | Proteus mirabilis strain Pm1LENAR tRNA modification GTPase (trmE) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | MH734355 (19160..19281 [+], 122 nt) |
| oriT length | 122 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 122 nt
>oriT_SGI-0
TATAATTCGCGCACATTCGTGCGCGGTACGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TATAATTCGCGCACATTCGTGCGCGGTACGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 519 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI-0 | GenBank | MH734355 |
| Element size | 31249 bp | Coordinate of oriT [Strand] | 19160..19281 [+] |
| Host bacterium | Proteus mirabilis strain Pm1LENAR tRNA modification GTPase (trmE) | Coordinate of element | 1..31249 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |