Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200580 |
Name | oriT_SGI1-LK1 |
Organism | Proteus mirabilis strain Pm294MATLI sequence |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | MH734354 (11904..12027 [+], 124 nt) |
oriT length | 124 nt |
IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI1-LK1
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 517 | Element type | IME (Integrative mobilizable element) |
Element name | SGI1-LK1 | GenBank | MH734354 |
Element size | 65023 bp | Coordinate of oriT [Strand] | 11904..12027 [+] |
Host bacterium | Proteus mirabilis strain Pm294MATLI sequence | Coordinate of element | 1..65023 |
Cargo genes
Drug resistance gene | aac(3)-Id, aadA7, qacE, sul1, tet(A), aph(6)-Id, aph(3'')-Ib, blaCARB-2, tet(G), floR, dfrA15, aph(3')-Ia, blaTEM-1B |
Virulence gene | - |
Metal resistance gene | merE, merD, merA, merP, merT, merR |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |