Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200579 |
| Name | oriT_IEVchRus1  |
| Organism | Vibrio cholerae strain |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | SMZE01000022 (25490..25603 [+], 114 nt) |
| oriT length | 114 nt |
| IRs (inverted repeats) | 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 114 nt
>oriT_IEVchRus1
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 516 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVchRus1 | GenBank | SMZE01000022 |
| Element size | 49006 bp | Coordinate of oriT [Strand] | 25490..25603 [+] |
| Host bacterium | Vibrio cholerae strain | Coordinate of element | 7039..37242 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |