Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200576 |
| Name | oriT_IEVchChn1  |
| Organism | Vibrio cholerae strain 571-88 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | JIDO01000028 (22480..22593 [+], 114 nt) |
| oriT length | 114 nt |
| IRs (inverted repeats) | 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 114 nt
>oriT_IEVchChn1
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 513 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVchChn1 | GenBank | JIDO01000028 |
| Element size | 45882 bp | Coordinate of oriT [Strand] | 22480..22593 [+] |
| Host bacterium | Vibrio cholerae strain 571-88 | Coordinate of element | 7137..34331 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |