Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200574 |
| Name | oriT_IEEcoMOD1  |
| Organism | Escherichia coli strain MOD1-EC5437 MOD1-EC5437_6_length_212547_cov_53.5408 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NLPO01000006 (6935..7051 [-], 117 nt) |
| oriT length | 117 nt |
| IRs (inverted repeats) | 60..66, 70..76 (CGGGGGT..ACCCCCG) 27..34, 48..55 (AAGCCTTG..CAAGGCTT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 117 nt
>oriT_IEEcoMOD1
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCGTTGAGGCACAAGGCTTCCGTCGGGGGTTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCGTTGAGGCACAAGGCTTCCGTCGGGGGTTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 511 | Element type | IME (Integrative mobilizable element) |
| Element name | IEEcoMOD1 | GenBank | NLPO01000006 |
| Element size | 212547 bp | Coordinate of oriT [Strand] | 6935..7051 [-] |
| Host bacterium | Escherichia coli strain MOD1-EC5437 MOD1-EC5437_6_length_212547_cov_53.5408 | Coordinate of element | 57370..82980 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |