Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200573 |
| Name | oriT_IEVmeUSA1  |
| Organism | Vibrio metoecus strain 07-2435 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | LCUE01000016 (18754..18867 [+], 114 nt) |
| oriT length | 114 nt |
| IRs (inverted repeats) | 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | 72..73 |
| Conserved sequence flanking the nic site |
GTGTGTAATC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 114 nt
>oriT_IEVmeUSA1
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAATCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAATCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 510 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVmeUSA1 | GenBank | LCUE01000016 |
| Element size | 42166 bp | Coordinate of oriT [Strand] | 18754..18867 [+] |
| Host bacterium | Vibrio metoecus strain 07-2435 | Coordinate of element | 7207..30724 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |