Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200572 |
| Name | oriT_IEVchN2786  |
| Organism | Vibrio cholerae strain N2786 NODE_8 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | VSHP01000008 (7884..7997 [-], 114 nt) |
| oriT length | 114 nt |
| IRs (inverted repeats) | 32..39, 53..60 (AAGCCTTA..TAAGGCTT) 39..44, 55..60 (AAGCCT..AGGCTT) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 114 nt
>oriT_IEVchN2786
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTAAGCCTATGAGGCATAAGGCTTCCATCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTAAGCCTATGAGGCATAAGGCTTCCATCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 509 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVchN2786 | GenBank | VSHP01000008 |
| Element size | 68167 bp | Coordinate of oriT [Strand] | 7884..7997 [-] |
| Host bacterium | Vibrio cholerae strain N2786 NODE_8 | Coordinate of element | 36531..61188 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |