Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200571 |
| Name | oriT_GIVchO27-1  |
| Organism | Vibrio cholerae strain 10432-62 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | CP010812 (7625..7742 [-], 118 nt) |
| oriT length | 118 nt |
| IRs (inverted repeats) | 60..65, 72..77 (CGGGGG..CCCCCG) 27..34, 48..55 (AAGCCTTG..CAAGGCTT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 118 nt
>oriT_GIVchO27-1
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCGTTGAGGCACAAGGCTTCCGTCGGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCGTTGAGGCACAAGGCTTCCGTCGGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 508 | Element type | IME (Integrative mobilizable element) |
| Element name | GIVchO27-1 | GenBank | CP010812 |
| Element size | 4077462 bp | Coordinate of oriT [Strand] | 7625..7742 [-] |
| Host bacterium | Vibrio cholerae strain 10432-62 | Coordinate of element | 4044276..4070921 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |