Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200568 |
| Name | oriT_IEVchN2744  |
| Organism | Vibrio cholerae strain N2744 NODE_35 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | VSGF01000021 (7276..7384 [-], 109 nt) |
| oriT length | 109 nt |
| IRs (inverted repeats) | 60..65, 71..76 (CGGGGG..CCCCCG) 27..34, 48..55 (AAGCCTTG..CAAGGCTT) 35..40, 49..54 (AGCCTT..AAGGCT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 109 nt
>oriT_IEVchN2744
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 505 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVchN2744 | GenBank | VSGF01000021 |
| Element size | 48743 bp | Coordinate of oriT [Strand] | 7276..7384 [-] |
| Host bacterium | Vibrio cholerae strain N2744 NODE_35 | Coordinate of element | 11630..41763 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |