Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200568 |
Name | oriT_IEVchN2744 |
Organism | Vibrio cholerae strain N2744 NODE_35 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | VSGF01000021 (7276..7384 [-], 109 nt) |
oriT length | 109 nt |
IRs (inverted repeats) | 60..65, 71..76 (CGGGGG..CCCCCG) 27..34, 48..55 (AAGCCTTG..CAAGGCTT) 35..40, 49..54 (AGCCTT..AAGGCT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 109 nt
>oriT_IEVchN2744
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 505 | Element type | IME (Integrative mobilizable element) |
Element name | IEVchN2744 | GenBank | VSGF01000021 |
Element size | 48743 bp | Coordinate of oriT [Strand] | 7276..7384 [-] |
Host bacterium | Vibrio cholerae strain N2744 NODE_35 | Coordinate of element | 11630..41763 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |