Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200567 |
| Name | oriT_IMEVchUSA3  |
| Organism | Vibrio cholerae strain OYP6G08 Vc_OYP6G08_Contig_9 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NMSY01000009 (8330..8443 [-], 114 nt) |
| oriT length | 114 nt |
| IRs (inverted repeats) | 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 114 nt
>oriT_IMEVchUSA3
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCGTCTCTGTTTACGCCGATGGCGACAGAGACGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 504 | Element type | IME (Integrative mobilizable element) |
| Element name | IMEVchUSA3 | GenBank | NMSY01000009 |
| Element size | 50391 bp | Coordinate of oriT [Strand] | 8330..8443 [-] |
| Host bacterium | Vibrio cholerae strain OYP6G08 Vc_OYP6G08_Contig_9 | Coordinate of element | 12429..43338 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |