Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200566 |
| Name | oriT_IEVchBan1  |
| Organism | Vibrio cholerae O1 str. EM-1676A |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KB662834 (19778..19900 [-], 123 nt) |
| oriT length | 123 nt |
| IRs (inverted repeats) | 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 123 nt
>oriT_IEVchBan1
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCCGTCTCTGTTTACGCCTACGGCAACAGAGACGGGGTGGAGCAT
TATGATTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTATGAGGCATAAGGCTTTCGTCGGGTGTGTAACCCCCCGTCTCTGTTTACGCCTACGGCAACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 503 | Element type | IME (Integrative mobilizable element) |
| Element name | IEVchBan1 | GenBank | KB662834 |
| Element size | 55308 bp | Coordinate of oriT [Strand] | 19778..19900 [-] |
| Host bacterium | Vibrio cholerae O1 str. EM-1676A | Coordinate of element | 11528..48046 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |