Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200565 |
| Name | oriT_GIE492  |
| Organism | Klebsiella pneumoniae RYC492 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | APGM01000001 (15955..16077 [+], 123 nt) |
| oriT length | 123 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 123 nt
>oriT_GIE492
CCGTTCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTCGAGCCTGCGAGATAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
CCGTTCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTCGAGCCTGCGAGATAAAACAGGCGAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 502 | Element type | IME (Integrative mobilizable element) |
| Element name | GIE492 | GenBank | APGM01000001 |
| Element size | 5095761 bp | Coordinate of oriT [Strand] | 15955..16077 [+] |
| Host bacterium | Klebsiella pneumoniae RYC492 | Coordinate of element | 1705122..1727413 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iroB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |