Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200555
Name   oriT_SGI1-PmSCO in_silico
Organism   
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   -
oriT length   124 nt
IRs (inverted repeats)      65..70, 76..81  (CGGGGG..CCCCCG)
 43..49, 51..57  (CCTTGAG..CTCAAGG)
 8..14, 19..25  (CGCGCAC..GTGCGCG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 124 nt

>oriT_SGI1-PmSCO
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   0 Element type   
Element name    GenBank   
Element size    Coordinate of oriT [Strand]   
Host bacterium   

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -