Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 200554
• Name: oriT_SGI1-PmMAT
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 124 nt
• IRs (inverted repeats): 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 124 nt

>oriT_SGI1-PmMAT
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 0

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -