Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200548 |
| Name | oriT_PGI1-PmCHE |
| Organism | Proteus mirabilis strain PmCHE |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KJ439039 (22974..23090 [+], 117 nt) |
| oriT length | 117 nt |
| IRs (inverted repeats) | 60..65, 71..76 (CGGGGG..CCCCCG) 35..40, 49..54 (AGCCTT..AAGGCT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 117 nt
>oriT_PGI1-PmCHE
TTCGCGCACATTCGTGCGCGGGGCGAAAGTCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TTCGCGCACATTCGTGCGCGGGGCGAAAGTCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 490 | Element type | IME (Integrative mobilizable element) |
| Element name | PGI1-PmCHE | GenBank | KJ439039 |
| Element size | 86128 bp | Coordinate of oriT [Strand] | 22974..23090 [+] |
| Host bacterium | Proteus mirabilis strain PmCHE | Coordinate of element | 1..86128 |
Cargo genes
| Drug resistance gene | ant(2'')-Ia, aadA2, qacE, sul1, blaTEM-1B, ant(3'')-Ia, tet(A), aph(6)-Id, aph(3'')-Ib |
| Virulence gene | - |
| Metal resistance gene | merR, merE, merD, merA, merF, merT, merR2 |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |