Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200545 |
| Name | oriT_SGI2[SGI1-J]  |
| Organism | Salmonella enterica subsp. enterica serovar Emek SGI2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | AY963803 (19015..19138 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI2[SGI1-J]
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 487 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI2[SGI1-J] | GenBank | AY963803 |
| Element size | 47132 bp | Coordinate of oriT [Strand] | 19015..19138 [+] |
| Host bacterium | Salmonella enterica subsp. enterica serovar Emek SGI2 | Coordinate of element | 1..47132 |
Cargo genes
| Drug resistance gene | dfrA1, qacE, floR, tet(G), sul1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |