Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200541 |
| Name | oriT_SGI1-W  |
| Organism | Proteus mirabilis strain PmC105 tRNA modification GTPase (thdF) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KJ186151 (17871..17994 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI1-W
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 483 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI1-W | GenBank | KJ186151 |
| Element size | 36585 bp | Coordinate of oriT [Strand] | 17871..17994 [+] |
| Host bacterium | Proteus mirabilis strain PmC105 tRNA modification GTPase (thdF) | Coordinate of element | 133..34041 |
Cargo genes
| Drug resistance gene | aadA2, lnu(F), qacE, sul1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |