Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200540 |
| Name | oriT_SGI1-V  |
| Organism | Proteus mirabilis strain VB1248 Salmonella |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | HQ888851 (20229..20350 [+], 122 nt) |
| oriT length | 122 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 122 nt
>oriT_SGI1-V
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 482 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI1-V | GenBank | HQ888851 |
| Element size | 52387 bp | Coordinate of oriT [Strand] | 20229..20350 [+] |
| Host bacterium | Proteus mirabilis strain VB1248 Salmonella | Coordinate of element | 451..43372 |
Cargo genes
| Drug resistance gene | aac(6')-Ib, ant(2'')-Ia, dfrA1, qacE, sul1, tet(A), blaVEB-6, qnrA1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |