Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 200537 |
Name | oriT_SGI1-O |
Organism | Proteus mirabilis strain PmX59 tRNA modification GTPase (thdF) |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | KJ186150 (17871..17994 [+], 124 nt) |
oriT length | 124 nt |
IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI1-O
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 479 | Element type | IME (Integrative mobilizable element) |
Element name | SGI1-O | GenBank | KJ186150 |
Element size | 35904 bp | Coordinate of oriT [Strand] | 17871..17994 [+] |
Host bacterium | Proteus mirabilis strain PmX59 tRNA modification GTPase (thdF) | Coordinate of element | 139..33361 |
Cargo genes
Drug resistance gene | dfrA1, qacE, sul1 |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |