Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200535 |
| Name | oriT_SGI1-K7  |
| Organism | Proteus mirabilis isolate Pm37THOMI sequence |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | MF372717 (16350..16473 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI1-K7
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 477 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI1-K7 | GenBank | MF372717 |
| Element size | 57468 bp | Coordinate of oriT [Strand] | 16350..16473 [+] |
| Host bacterium | Proteus mirabilis isolate Pm37THOMI sequence | Coordinate of element | 1348..56490 |
Cargo genes
| Drug resistance gene | aph(6)-Id, tet(A), sul1, qacE, aadA7, aac(3)-Id, blaTEM-1B, aac(3)-IIa, blaCTX-M-15 |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |