Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200532 |
| Name | oriT_SGI1-F  |
| Organism | Salmonella enterica subsp. enterica serovar Cerro strain SRC5 TrmE (trmE) IntSGI1-F (intSGI1-F) S002 (S002) Rep (rep) S004 (S004) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KU847976 (17856..17979 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_SGI1-F
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCATAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 474 | Element type | IME (Integrative mobilizable element) |
| Element name | SGI1-F | GenBank | KU847976 |
| Element size | 45149 bp | Coordinate of oriT [Strand] | 17856..17979 [+] |
| Host bacterium | Salmonella enterica subsp. enterica serovar Cerro strain SRC5 TrmE (trmE) IntSGI1-F (intSGI1-F) S002 (S002) Rep (rep) S004 (S004) | Coordinate of element | 915..43564 |
Cargo genes
| Drug resistance gene | dfrA1, qacE, floR, tet(G), blaCARB-2, sul1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |