Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200530 |
| Name | oriT_PGI2  |
| Organism | Proteus mirabilis SGI1-relative multidrug-resistant |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | MG201402 (17873..17994 [+], 122 nt) |
| oriT length | 122 nt |
| IRs (inverted repeats) | 65..70, 76..81 (CGGGGG..CCCCCG) 43..49, 51..57 (CCTTGAG..CTCAAGG) 8..14, 19..25 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 122 nt
>oriT_PGI2
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TATAATTCGCGCACATTCGTGCGCGGTGCGAAAGCCTAGAGCCCTTGAGGCTCAAGGCTTCCGTCGGGGGCTCTACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 472 | Element type | IME (Integrative mobilizable element) |
| Element name | PGI2 | GenBank | MG201402 |
| Element size | 63899 bp | Coordinate of oriT [Strand] | 17873..17994 [+] |
| Host bacterium | Proteus mirabilis SGI1-relative multidrug-resistant | Coordinate of element | 1400..62977 |
Cargo genes
| Drug resistance gene | dfrA16, blaCARB-2, aadA2, cmlA1, ant(3'')-Ia, qacE, sul1, aph(3')-Ia, aac(3)-IVa, aph(4)-Ia, sul2, floR, lnu(F) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |