Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200529 |
| Name | oriT_PGI1-PmPEL  |
| Organism | Proteus mirabilis strain PEL ThdF (thdF) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KF856624 (19852..19968 [+], 117 nt) |
| oriT length | 117 nt |
| IRs (inverted repeats) | 60..65, 71..76 (CGGGGG..CCCCCG) 27..34, 48..55 (AAGCCTTG..CAAGGCTT) 35..40, 49..54 (AGCCTT..AAGGCT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 117 nt
>oriT_PGI1-PmPEL
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TTCGCGCACATTCGTGCGCGGGGCGAAAGCCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 471 | Element type | IME (Integrative mobilizable element) |
| Element name | PGI1-PmPEL | GenBank | KF856624 |
| Element size | 67496 bp | Coordinate of oriT [Strand] | 19852..19968 [+] |
| Host bacterium | Proteus mirabilis strain PEL ThdF (thdF) | Coordinate of element | 469..65262 |
Cargo genes
| Drug resistance gene | aac(6')-Ib, ant(2'')-Ia, dfrA1, qacE, sul1, tet(A), blaVEB-6, aph(3')-VI, blaNDM-1 |
| Virulence gene | - |
| Metal resistance gene | merR2, merT, merP, merF, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |