Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 200528 |
| Name | oriT_PGI1-PmESC  |
| Organism | Proteus mirabilis strain PmESC Proteus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | KU499917 (19849..19965 [+], 117 nt) |
| oriT length | 117 nt |
| IRs (inverted repeats) | 60..65, 71..76 (CGGGGG..CCCCCG) 35..40, 49..54 (AGCCTT..AAGGCT) 3..9, 14..20 (CGCGCAC..GTGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 117 nt
>oriT_PGI1-PmESC
TTCGCGCACATTCGTGCGCGGGGCGAAAGTCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
TTCGCGCACATTCGTGCGCGGGGCGAAAGTCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 470 | Element type | IME (Integrative mobilizable element) |
| Element name | PGI1-PmESC | GenBank | KU499917 |
| Element size | 43245 bp | Coordinate of oriT [Strand] | 19849..19965 [+] |
| Host bacterium | Proteus mirabilis strain PmESC Proteus | Coordinate of element | 451..42886 |
Cargo genes
| Drug resistance gene | ant(2'')-Ia, aadA2, qacE, sul1 |
| Virulence gene | - |
| Metal resistance gene | merR2, merT, merF, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |