Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200527
Name   oriT_PGI1-PmCHA in_silico
Organism   Proteus mirabilis strain PmCHA
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   KJ411925 (22974..23090 [+], 117 nt)
oriT length   117 nt
IRs (inverted repeats)      60..65, 71..76  (CGGGGG..CCCCCG)
 35..40, 49..54  (AGCCTT..AAGGCT)
 3..9, 14..20  (CGCGCAC..GTGCGCG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 117 nt

>oriT_PGI1-PmCHA
TTCGCGCACATTCGTGCGCGGGGCGAAAGTCTTGAGCCTTTGAGGCACAAGGCTTCCGTCGGGGGCTATACCCCCGTCTCTGTTTACGCCTACGGCGACAGAGACGGGGTGGAGCAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   469 Element type   IME (Integrative mobilizable element)
Element name   PGI1-PmCHA GenBank   KJ411925
Element size   88202 bp Coordinate of oriT [Strand]   22974..23090 [+]
Host bacterium   Proteus mirabilis strain PmCHA Coordinate of element   1..88202

Cargo genes


Drug resistance gene   ant(2'')-Ia, aadA2, qacE, sul1, blaTEM-1B, aph(3')-Ia, ant(3'')-Ia, tet(A), aph(6)-Id, aph(3'')-Ib
Virulence gene   -
Metal resistance gene   merR, merE, merD, merA, merF, merT, merR2
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -