Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   200524
Name   oriT_MGIVchMoz6 in_silico
Organism   Vibrio cholerae strain 16AMOZ
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   KC117175 (5288..5567 [-], 280 nt)
oriT length   280 nt
IRs (inverted repeats)      234..239, 251..256  (GCCAAA..TTTGGC)
 74..79, 90..95  (ATCAAA..TTTGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 280 nt

>oriT_MGIVchMoz6
GCTGTTTGGCTGTGTTCGCCAAGTGCAAAAAAATCGAGACGCCAAACGATCGTTTGCATTCTGGATTTAAAAAATCAAACGGTTTGTACTTTGATGCCGAGGTTGGTTTAGGGGGCAAAAAGTGCCAAACCTTGCTTTGAGCCAGTACTGGCAAGGCCTACCAGCGTTGGATTTCAATCGAGACGCCAAACAGTAAATGGGCTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCGTAAGGGGGTAAAGGCATGGGGAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   466 Element type   IME (Integrative mobilizable element)
Element name   MGIVchMoz6 GenBank   KC117175
Element size   18824 bp Coordinate of oriT [Strand]   5288..5567 [-]
Host bacterium   Vibrio cholerae strain 16AMOZ Coordinate of element   1..18824

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -